PlasmoGEM vector (recombineering) primers

PlasmoGEM vectors are made by recombineering and each vector design is associated with a recombineering primer pair (RecUp and RecDown) with each primer consisting of:

• 50 bp oligonucleotide sequences homologous to the targeting region of the gene of interest.
• 20 bp oligonucleotide sequences annealing to the zeo/pheS bacterial selection marker.
These are designated "R1" and "R2": The names refer to the attR1 and attR2 sites of the selection cassette and determines the orientation of the resistance marker in the final construct.
• Tagging designs always use the "RecUpR1/RecDownR2" orientation.
• Knock-out designs can also use "RecUpR1/RecDownR2", but the preferred orientation is "RecUpR2/RecDownR1", which inserts the selection marker in reverse direction to the target gene.
• 11 bp gene-specific molecular barcode and 18 bp annealing site for barcode amplification primer (RecDown only).

There are also a set of diagnostic or quality control primers for each construct: QCR1 (quality control R1):

• In knock-out designs, this primer anneals between recUp and recDown in the region of the genome that will be substituted for the selection cassette.
• In 3' tagging designs, it anneals upstream of the recUp primer.
• QCR2 (quality control R2): anneals downstream of recDown
• GT (genotyping): Anneals up- or downstream of PbG clone homology region.

Together, QCR1 and QCR2 can be used to detect the wt locus.

Verification of insertion of the hdhfr/yfcu selection cassette into the correct location (modified target locus) of your vector can be done by using a combination of the QCR2 and GW2 primers.

QCR2 and GW2 can be used to verify your vector by PCR and to detect the integrated and unintegrated vector in your transfectant parasite population.

For genotyping by long-range PCR, the gene specific GT primer can be used together with the generic primer GW2 or GW1 (integration PCR), depending on positioning and direction of the GT primer.

GW1 and GW2 are static (do not depend on individual design). Their sequences are:

• GW1 primer: 5'-catactagccattttatgtg-3'
• GW2 primer: 5'-ctttggtgacagatactac-3'

Barcode sequencing (barseq) primers

All PlasmoGEM vectors are equipped with an 11 bp unique molecular barcode that can be used to identify and quantify parasites in a mixed pool of mutants by barcode sequencing (barseq).

The 11 bp variable barcode can be amplified by the barcode amplicon (BA) primer pair:

• BA primer: 5'GTAATTCGTGCGCGTCAG
• BA2 primer: 5'CCTTCAATTTCGATGGGTAC

Sequencing libraries from pools of barcoded mutants can be generated by a nested PCR approach using the method described in Gomes et al. 2015 with PCR primer sequences also being available as an Excel file here